Customize Link To Ncbi Blast Search
I want to insert a link to NCBI Blast search into web page with given GI and coordinates. Link like this:<a...
View ArticleBlast Is Giving Me A Result Totally Unrelated To The Gene I Expect
Hello,After I obtained the results from sequencing, I proceeded to curate the sequences and identifying (with Vector NTI) the primers I used in the sequence. The primers, although are degenerated, were...
View ArticleBlastp Against Human Proteome
Hey guys,I have a list of gi's for about 10000 protein sequences all from vertebrate species. I want to blast these sequences against non-redundant protein sequences only from humans. I will run the...
View ArticleVertebrate Subset Nr Database? Build My Own?
I think I have the answer to my own question, but I'm somewhat new to bioinformatics, and I want to make sure my strategy is sound (and that there are no easier solutions to my problem). We need to...
View ArticleBlast Database Size Influence On Number Of Significant Hits
I have a set of gene sequences and specific sequence.cat genes.fa>Gene_1_chr1_1000_1200 ACGT...>Gene_2_chr2_3000_3400 TTAT... cat sequence.fa >Searchable_sequence ACGG... I want to search for...
View ArticleBlast K and Lambda
Hello, I have a question about Blast parameter. In Blast search results, for different queries the K and Lambda value is different for Ungapped search. For gapped search , they are the same.However,...
View ArticleBlastp With Just Top Result From Each Organism
(My first Q on biostar, forgive any transgressions please!)I would like to blast a protein/aa sequence and filter(?) my results to include only the top result from each organism. I'm keen to use R or...
View ArticleBest Hits From Blast Tabular Output Of Multiple-Queries
Hello. I have been trying to get the best hits out of blast output files. I know that -v option or maxtargetseqs in standalone blast gives the best ones. But I already have a huge output of multiple...
View ArticleClik here to view.
Tool: Automatically download NCBI Blast databases
HiI thought to share this tool, in case you need it. The tool automatically downloads ALL NCBI blast databases from NCBI ftp server. Limitations:You can stop a download and resume later as long as you...
View ArticleWhat Program Or Database To Use To Analyze Blast Result Output?
Hello, I ran the blast locally and got the blast output like followingquery1 gi|4003386|dbj|AB020866.1| 98.44 64 1 .. query2 gi|60834728|gb|AY894071.1| 92.11 76 2 ... query3 gi|21618453|gb|BC032801.1|...
View Articleconverting a fasta database to blastp database
hello im runnnig a wwwblast software on my server i do have a fasta database and i would like to use it in wwwblast i googled it a little and found that " makeblastdb " does the job i used this command...
View ArticleAlmost Nothing Mapped Using Bwa Or Bowtie. But A Lot Of Mapping In Blast
I have pair-ended illumina samples with the read length of 100-150bp. I tried to map them to the reference genome/transcritpome, but almost nothing mapped using BWA or Bowtie.When I blast them to nt...
View ArticleHow To Examine Whether Homology Search Method Used(Blast/Hmmer) Is Feasible...
Hallo...how to one examine whether homology method used is feasible for identification of a particular gene family e.g HSP. Suppose i have identified 550 sequences suspected to be a particular gene...
View ArticleWhat'S The Different Between Formatdb (In The Legacy Blast) And Makeblastdb...
Hi all, in the legacy BLAST, the command formatdb is used for formating fasta files into BLAST database. Then in BLAST+, makeblastdb is used. And I tried to apply blastx+ on a database formatted by...
View ArticleTurn Off Blast Search On Reverse Complement Strand In Blastn
I have a quick question: How can I turn off search on reverse complement strand of my query nucleotide sequence in blastn?For example, I don't want 'GUAAAGCCAAAUCUUCGGUUA' to be a hit when I use...
View ArticleBlastx With Xml Format
Hi all, I'm currently using standard alone blast, the version is ncbi-blast-2.2.25+. I tried to made xml format blast result for my downstream analysis, but I had some problems in generating it. The...
View ArticleWhat is the best approach for predicting regulatory elements in the pig genome
Hi All,What is the best computational method for predicting regulatory elements in the pig genome? I have a list of differentially expressed genes as determined by RNA-Seq in 3 different tissues and I...
View ArticleI Do Get Blast Hits, But The Mapping Step (For Some Hits) Returns No Gos
In blast2go I do get blast hits but the mapping step (for some hits) returns no GOs. and also after annotation some mapped hits, hasnt any annotation (they stay green). And I have to tell you, the...
View Articlein-house blast DB creation
Hello,I hope this command line explains what I am asking... makeblastdb -in a.fasta -dbtype prothead -10 a.fasta >a.part.fastablastx -query a.part.fasta -db ./a.fasta I got "No hits found" .... I...
View ArticleAlignment Matrix
Dear all,I have a problem with the following website:http://www.nature.com/scitable/topicpage/basic-local-alignment-search-tool-blast-29096More specific, I have a problem with the matrix (completely...
View Article