Quantcast
Channel: Post Feed
Viewing all articles
Browse latest Browse all 41826

Turn Off Blast Search On Reverse Complement Strand In Blastn

$
0
0

I have a quick question: How can I turn off search on reverse complement strand of my query nucleotide sequence in blastn?

For example, I don't want 'GUAAAGCCAAAUCUUCGGUUA' to be a hit when I use 'UAACCGAAGAUUUGGCUUUAC' as the query.

Maybe I missed it when I read the man page, but I really appreciate it if someone can point out the parameter I should use.

Thanks!


Viewing all articles
Browse latest Browse all 41826

Latest Images

Trending Articles



Latest Images