I used makeblastdb to search many short fasta sequences in a known organism. I successfully completed this step and got the mappings. My question is
1. how can I get the start and stop coordinate ?
for eg
Query 1 AATATAGGTGGTACCACGGAATATCCGTCCTATTTGTATATAGGATGGATAtttttattt 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1765181 AATATAGGTGGTACCACGGAATATCCGTCCTATTTGTATATAGGATGGATATTTTTATTT 1765122 Query 61 ttttAGGAGGTATAGCAAATGG 82 |||||||||||||||||||||| Sbjct 1765121 TTTTAGGAGGTATAGCAAATGG 1765100
How to get 1765100 and 1765181 from a text file with many mappings like this. I would also like to count the number of mappings or query sequences?