We are creating assays using primer 3.
Primer left: AGCTGTACCATACCTGTCTGG Start / stop position: chr1 115252177 - 115252198Primer right: AGGGAGCAGATTAAGCGAGT Start / stop position: chr1 115252351 - 115252371
There is quite a distance between our two primers: 115252351 - 115252198 = 153 bases.
We are currently running specificity checks against each individual primer, using BLAST. I have been told that it is possible to check the specificity of the assay as a whole, by submitting the two primers separated by N's.
ie:
AGCTGTACCATACCTGTCTGGNNNNNNNNNNNNNNNNNNAGGGAGCAGATTAAGCGAGT
Questions
1) Is this a correct way to blast both sides of the assay?
2) Must the number of N's match the distance between the primers (153 in the case) or is an arbitrary number sufficient?