Blast The Sequences Obtained From Translocations To Get Their Positions

HI I have a file that contains information like this:

Gene1 Gene2 sequence
FOXP1    ABL1    acacctctcaatgcagctttacagCtctacgtctcctccgagagccgctgtggagagttacgtcgaaatgtc
 FUS    ATF1    TATGGACAGCAGAACCAGTACAACAGCAGCAGTGGTGGTGGAGGTGGAGGTGGAGGTGGAGTTGCCATTGCCCCAAATGGAGCCTTACAGTTGGCAAGTCCAGGCACAGATGGAGTACA
 FUS    CREB3L1    ttgagtctgtggctgattacttcaagcagattgGctctctgcccccctccagccctgtcaggcccatg
 FUS    CREB3L1    TATGGACAGCAGGACCGTGGAGGCCGCGcCACGGCCATCTCCACCTCCCCACTCCTCACTGCCCCTCACAAA

These genes are known to be involved in the translocation and the sequence contains part of Gene1 and part of Gene2. for example the sequence acacctctcaatgcagctttacagCtctacgtct belongs to FOXP1 and cctccgagagccgctgtggagagttacgtcgaaatgtc might belong to ABL1.

I have thousands of such sequences and i want to exacly locate where in the gene that translocation occurs i,e., the genomic positions where that part of the sequence belongs

   gene1   genomic_position       translocation_occurs         gene2   genomic_position       translocation_occurs
   FOXP1 chr6:98925342-99435345 chr6:98925380-chr6:98925414   ABL1 chr2:31688556-31804227 chr2:31688756 31688794

How can i get such information i have thousands of such sequences