I tried to find a short oligonucleotide sequence (probe) in a transcript and I knew for sure that the transcript contained the probe. But the latest version of the BLAST stand-alone algorithm (2.2.25+) found no match for the probe. Surprisingly enough, when I split the probe sequence in two parts both were found in the transcript one after the other. Moreover, when I deleted the two first nucleotides from the probe sequence, BLAST managed to find the correct matching. Could anyone explain what kind of problem I am facing? I do have about 20 such probe sequences that were not found by BLAST even if there was a perfect matching.
I tried to find matching with the following parameters:
blastn -query probe.fa -db target -task blastn-short -word_size 7 -evalue 100 -out res.outUPDATE: It was really helpful to change the -wordsize parameter to 5. The BLASTN algorithm managed to find the correct matching. BUT there are still several probes, for which it fails to find the correct matching although the transcript contains the probe sequence for sure. The stand-alone BLAST version allows to set the -wordsize parameter >=4, but even with -word_size=4 the matching couldn't be found. The online BLAST finds the matching. What should I do in this case? The new problem data is:
>probe_seq CCCCCCCCTCGGAGAGAGAGAGA >transcript_seq tccctctcccccccttctctctctctccgaggggggggggtcccagggagggaggggggg tcccccgatcagcatgtgg ...
