Tools Parsing Ncbi Blast -M 7 Xml Output Format?

Hi all,

Is there any script or tool which is able to parse NCBI blast xml output (produced with -m 7 option) ?

I want a tab delimited file containing the following information:

 Name of the query sequence             Seq1
 2. Length of the query sequence           30
 3. Name of target sequence                gnl|BL_ORD_ID|0
 4. Length of target sequence              5528445
 5. Alignment bit score                    59.96
 6. E-value                                8.38112e-11
 7. Start of alignment within query        1
 8. End of alignment within query          30
 9. Start of alignment within target       5436010
10. End of alignment within target         5436039
11. Query frame                            1
12. Target frame                           1
13. Number of identical bases within       29
    the alignment
14. Alignment length                       30
15. Aligned portion (sequence) of query    CGGACAGCGCCGCCACCAACAAAGCCACCA
16. Aligned portion (sequence) of target   CGGACAGCGCCGCCACCAACAAAGCCATCA
17. Midline indicating positions of        ||||||||||||||||||||||||||| ||
    matches within the alignment

Thanks.

Elzed