Blastn error : ncbi::CObject::ThrowNullPointerException() - Attempt to access...
When I run blastn (version 2.15) and nt database (latest version) was extracted. I used aspera to download database from ncbi This is code I used to download database: ascp -T -i...
View ArticleHow Can I Automate Blast Of >1 Sequence And Output The Top Hits For Each Input?
I'm looking for a way to do BLAST simultaneously with >1 sequence. The input is several fasta files or one file containing several sequence formatted in fasta. For an initial testing, I want to try...
View ArticleHow To Show More Blast Results Using Biopython?
Hi,I'm using biopython to BLAST over the internet. However, it only saves 30 results (there are more than 30 results that are under the e-value I chose) in the xml. I've been looking all over but can't...
View ArticleBiopython Ncbistandalone Blastall Gives Different Result Than Calling...
So, first I tested what results I should get from the blastall program using the command line, with e-value 0.001: C:\Niek\Test\blast-2.2.17\bin\blastall -p blastp -d...
View ArticleAre there any online/offline internships in bioinformatics? Stipend does not...
Are there any online/offline internships in bioinformatics? Stipend does not matter. I'll be able to invest 2 hours per day. (I can’t give it more time than that because I have some competitive exams...
View Articlecarboxylesterases classification into subfamilies
Hi! I want to classify the carboxylesterases genes into subfamilies. There are about 17 subfamilies for these gene, but it is varying a lots in different species. so it is hard to find reference...
View ArticleBiopython Ncbistandalone Blastall Gives Different Result Than Calling...
So, first I tested what results I should get from the blastall program using the command line, with e-value 0.001: C:\Niek\Test\blast-2.2.17\bin\blastall -p blastp -d...
View ArticleHow To Show More Blast Results Using Biopython?
Hi,I'm using biopython to BLAST over the internet. However, it only saves 30 results (there are more than 30 results that are under the e-value I chose) in the xml. I've been looking all over but can't...
View ArticleTurn Off Blast Search On Reverse Complement Strand In Blastn
I have a quick question: How can I turn off search on reverse complement strand of my query nucleotide sequence in blastn?For example, I don't want 'GUAAAGCCAAAUCUUCGGUUA' to be a hit when I use...
View ArticleTaxonomy Of Blast Hits
Lets have 200k genomic contigs with some (unknown) bacterial contamination. I blasted (blastn vs nr) all of them, got tabulated output and passed the uniq acc nos ca 5k to Batch Entrez. Since neither...
View ArticleMerging Blastx Hits From Overlapping Bacterial Genome Segments
I blastx-ed 1Mbp bacterial genome fragment against NCBI nr database. I have split it into 2000bp fragments with 500bp overlap into a one multiple fasta file (splitter from EMBOSS) splitter -sequence...
View ArticleHow To Convert Blast Results To Gff
I'd like to visualise the results of a BLAST search in a genome browser. Is there a simple way to get the results in GFF format without having to write a parser myself?
View ArticlePerforming Blast/Smithwaterman Searches Directly From My Application
Bringing in my questions from stackoverflow:I'm working on a small application and thinking about integrating BLAST or other local alignment searches into my application. My searching has only brought...
View ArticleCompare Two Protein Sequences Using Local Blast
Hi,I have been given a task to compare the all the protein sequences of a strain of campylobacter with a strain of E.coli. I would like to do this locally using Biopython and the inbuilt Blast tools....
View ArticleCustom Matrices With Ncbi Blast
Does anyone have an idea on how to make NCBI BLAST work with custom Matrices? i.e. ones that are not provided by the BLOSUM series that come as a default with NCBI BLAST.
View ArticleBlast Motif With Regular Expression ?
Hi there =) Today I was asked if there is a possibility to BLAST (blastp) for a specific amino acid MOTIF spanning seven amino acids. However this MOTIF is 'dynamic' at 3 points: position 2 in the...
View ArticleRun A Blast Daemon
I want to run my own BLAST daemon to avoid loading my blast db into RAM for every query.When I google it: I get a page from IBM that is out-of-date and a lot of other pages about Buffy the Vampire...
View ArticleAnnotating Sequences For Gbrowse - Which Is The Database And Which Is The Query?
Let's say I have some small sequences that I wish to display in Gbrowse. I want to create tracks from Blast results to show where genic regions might be.Do I create a Blast index of the small sequences...
View ArticleBlastp And Biopython
I have noticed that when I blast my own database in particular some of the sequences get truncated. This is using my local blast algorithm. For example I know that the sequence `FYNTSTPQ` and...
View ArticleGet Pairwise Sequence Identity
Hey,for some project I need to run pairwise sequence alignments (local ones, i.e. Smith-Waterman) on protein sequences in order to produce a similarity matrix based on the percentage of identical...
View Article![Cloonee, Yandel & ATLAC – Movimiento – Single [iTunes Plus M4A]](http://i.imgur.com/Q8tO40p.jpeg)
